ID: 903241791_903241799

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 903241791 903241799
Species Human (GRCh38) Human (GRCh38)
Location 1:21987579-21987601 1:21987610-21987632
Sequence CCCATCTGGTTCTGCACCAAGTT ATGTGGTGACCTCCTGGGAGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 87} {0: 2, 1: 25, 2: 58, 3: 68, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!