ID: 903335397_903335406

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 903335397 903335406
Species Human (GRCh38) Human (GRCh38)
Location 1:22621146-22621168 1:22621185-22621207
Sequence CCATCCATGATGGGAAACTGAGG CTTACTCAAGGCAAGCACATGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!