ID: 903597013_903597024

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 903597013 903597024
Species Human (GRCh38) Human (GRCh38)
Location 1:24502784-24502806 1:24502825-24502847
Sequence CCCCGCCTTGTCCTGGGCTCTGG CGCGCCCTGCCAGAACAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 51, 4: 491} {0: 1, 1: 0, 2: 0, 3: 3, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!