|
Left Crispr |
Right Crispr |
| Crispr ID |
903705518 |
903705524 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:25282736-25282758
|
1:25282771-25282793
|
| Sequence |
CCAAAAATTAGCCAGGCGTGGTG |
GGTTCCCACTGAAGCACAGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 132, 1: 636, 2: 1078, 3: 1323, 4: 1511} |
{0: 2, 1: 0, 2: 0, 3: 10, 4: 146} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|