ID: 903718768_903718775

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 903718768 903718775
Species Human (GRCh38) Human (GRCh38)
Location 1:25389014-25389036 1:25389035-25389057
Sequence CCACAAGACCCAGCACCATGGCA CAAGCCACGGAGAAGGGATCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 37, 4: 308} {0: 2, 1: 0, 2: 1, 3: 11, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!