ID: 903719626_903719632

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 903719626 903719632
Species Human (GRCh38) Human (GRCh38)
Location 1:25394912-25394934 1:25394931-25394953
Sequence CCCTCCTGCTGAAGAAACCCAGG CAGGCTGAATTGAAGTTTTGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 36, 4: 233} {0: 2, 1: 0, 2: 2, 3: 16, 4: 328}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!