|
Left Crispr |
Right Crispr |
| Crispr ID |
903722112 |
903722120 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:25413335-25413357
|
1:25413358-25413380
|
| Sequence |
CCGTCCATTATCTGGGCTCCCGC |
TTCAGGGCTGGGTCCCAGCTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 0, 2: 1, 3: 4, 4: 104} |
{0: 2, 1: 0, 2: 5, 3: 30, 4: 281} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|