ID: 903873635_903873639

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 903873635 903873639
Species Human (GRCh38) Human (GRCh38)
Location 1:26456330-26456352 1:26456350-26456372
Sequence CCACTGCACTCCAGTCTGGGCAA CAACAGAGGGAGACCCTGTCTGG
Strand - +
Off-target summary {0: 2698, 1: 74239, 2: 183554, 3: 229924, 4: 187733} {0: 3, 1: 32, 2: 126, 3: 364, 4: 769}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!