ID: 903961943_903961949

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 903961943 903961949
Species Human (GRCh38) Human (GRCh38)
Location 1:27063469-27063491 1:27063484-27063506
Sequence CCCTCCACGGTCTCCCTCTGATG CTCTGATGCCGAGCCGAGGCTGG
Strand - +
Off-target summary No data {0: 67, 1: 556, 2: 575, 3: 370, 4: 216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!