ID: 904784935_904784943

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 904784935 904784943
Species Human (GRCh38) Human (GRCh38)
Location 1:32975776-32975798 1:32975812-32975834
Sequence CCGAGATGGCAGCAGTACCGTCC CATCAGAGGGAGACCGTGGAAGG
Strand - +
Off-target summary {0: 125, 1: 829, 2: 365, 3: 139, 4: 530} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!