ID: 904822824_904822836

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 904822824 904822836
Species Human (GRCh38) Human (GRCh38)
Location 1:33256443-33256465 1:33256485-33256507
Sequence CCAGCCTCCCGCCGCCGCCGCCG AGAACCCAGAAGTGAACAGCAGG
Strand - +
Off-target summary {0: 2, 1: 16, 2: 115, 3: 456, 4: 1830} {0: 1, 1: 0, 2: 0, 3: 18, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!