ID: 904822830_904822836

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 904822830 904822836
Species Human (GRCh38) Human (GRCh38)
Location 1:33256457-33256479 1:33256485-33256507
Sequence CCGCCGCCGCCGCCGCCTCGGCG AGAACCCAGAAGTGAACAGCAGG
Strand - +
Off-target summary {0: 3, 1: 22, 2: 316, 3: 2257, 4: 3967} {0: 1, 1: 0, 2: 0, 3: 18, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!