|
Left Crispr |
Right Crispr |
| Crispr ID |
905152696 |
905152701 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:35944271-35944293
|
1:35944298-35944320
|
| Sequence |
CCCAGGCTAGTCTCAAACTCCTA |
CCTAAGCCTCCTGAGTGTCTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 142, 1: 3403, 2: 26842, 3: 46275, 4: 59849} |
{0: 1, 1: 76, 2: 3778, 3: 113924, 4: 218970} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|