ID: 905390964_905390968

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 905390964 905390968
Species Human (GRCh38) Human (GRCh38)
Location 1:37634996-37635018 1:37635010-37635032
Sequence CCGGCCCGGGAGTCCACACGTCC CACACGTCCTTGCCCGAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 108} {0: 1, 1: 0, 2: 0, 3: 3, 4: 43}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!