ID: 905390964_905390979

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 905390964 905390979
Species Human (GRCh38) Human (GRCh38)
Location 1:37634996-37635018 1:37635044-37635066
Sequence CCGGCCCGGGAGTCCACACGTCC CCGAGCGCGGGGCTGGCGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 108} {0: 1, 1: 0, 2: 2, 3: 27, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!