ID: 905390966_905390975

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 905390966 905390975
Species Human (GRCh38) Human (GRCh38)
Location 1:37635001-37635023 1:37635037-37635059
Sequence CCGGGAGTCCACACGTCCTTGCC CTGCGCTCCGAGCGCGGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 108} {0: 1, 1: 0, 2: 1, 3: 23, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!