ID: 905390978_905390982

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 905390978 905390982
Species Human (GRCh38) Human (GRCh38)
Location 1:37635044-37635066 1:37635065-37635087
Sequence CCGAGCGCGGGGCTGGCGGAGGG GGACAAGTCCCCAGGACCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 284} {0: 1, 1: 1, 2: 4, 3: 22, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!