ID: 905493383_905493394

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 905493383 905493394
Species Human (GRCh38) Human (GRCh38)
Location 1:38362881-38362903 1:38362929-38362951
Sequence CCTTCCACTGGGTCCCTCTCATG ATTCAAGATGAGATTTGGGTGGG
Strand - +
Off-target summary No data {0: 7461, 1: 10942, 2: 10318, 3: 7687, 4: 6503}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!