ID: 905664274_905664290

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 905664274 905664290
Species Human (GRCh38) Human (GRCh38)
Location 1:39753160-39753182 1:39753201-39753223
Sequence CCAGCGGGAGGGGCTGCTGCTGC GTGGGCAAATGGGCAGGCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 81, 4: 540} {0: 1, 1: 0, 2: 4, 3: 55, 4: 405}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!