ID: 905775795_905775802

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 905775795 905775802
Species Human (GRCh38) Human (GRCh38)
Location 1:40666301-40666323 1:40666350-40666372
Sequence CCATGTCTGGAGACATTTTTGGT CGTCTCATGAGAAGAGACCAGGG
Strand - +
Off-target summary {0: 19, 1: 56, 2: 83, 3: 122, 4: 333} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!