|
Left Crispr |
Right Crispr |
| Crispr ID |
905841759 |
905841767 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:41186616-41186638
|
1:41186637-41186659
|
| Sequence |
CCTAACCCCCAATGTGACTACAT |
ATTTGGAGACAGGGCATTTAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 38, 2: 151, 3: 453, 4: 1091} |
{0: 1, 1: 41, 2: 143, 3: 356, 4: 768} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|