ID: 906075514_906075528

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 906075514 906075528
Species Human (GRCh38) Human (GRCh38)
Location 1:43049198-43049220 1:43049251-43049273
Sequence CCTGATAGCTCCACATTGGCTTT CTCTGGCCCTGCCCTTGCCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 114, 3: 299, 4: 1252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!