ID: 906636208_906636222

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 906636208 906636222
Species Human (GRCh38) Human (GRCh38)
Location 1:47412349-47412371 1:47412390-47412412
Sequence CCCCTACCCCATGTTCCTTGCCT GTGGTGCCTTTGCAGAGCTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 24, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!