ID: 906636214_906636229

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 906636214 906636229
Species Human (GRCh38) Human (GRCh38)
Location 1:47412357-47412379 1:47412402-47412424
Sequence CCATGTTCCTTGCCTCAAGGCCT CAGAGCTGGGGCTGGGGGCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 31, 3: 255, 4: 1714}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!