ID: 906719685_906719703

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 906719685 906719703
Species Human (GRCh38) Human (GRCh38)
Location 1:47996525-47996547 1:47996570-47996592
Sequence CCGGGACAGGCAGGAGCGAAGGA GGGGGTGGAGGTGGAGCGGGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 29, 4: 265} {0: 1, 1: 0, 2: 27, 3: 536, 4: 4619}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!