|
Left Crispr |
Right Crispr |
| Crispr ID |
906827172 |
906827185 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:48993804-48993826
|
1:48993851-48993873
|
| Sequence |
CCCACAATCACTGCACTCTCCCT |
GATGCCAGGAGAAGGGGGAGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 16, 1: 45, 2: 113, 3: 186, 4: 416} |
{0: 1, 1: 0, 2: 9, 3: 128, 4: 1182} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|