ID: 907957527_907957533

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 907957527 907957533
Species Human (GRCh38) Human (GRCh38)
Location 1:59244395-59244417 1:59244411-59244433
Sequence CCAATTTCCCTTTTCTTAAAAGG TAAAAGGGCACTGGTCATATTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 23, 3: 204, 4: 837}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!