ID: 908696618_908696624

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 908696618 908696624
Species Human (GRCh38) Human (GRCh38)
Location 1:66849483-66849505 1:66849531-66849553
Sequence CCCCAAATGTCCAGGTTTCAATT CACGAAAATGTTAACTTGAATGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 22, 3: 76, 4: 346} {0: 1, 1: 0, 2: 2, 3: 14, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!