ID: 908806376_908806386

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 908806376 908806386
Species Human (GRCh38) Human (GRCh38)
Location 1:67937218-67937240 1:67937256-67937278
Sequence CCAATCATTCTAGTCAAAAGCAA CCTTTCAGCAGAAGAGGGAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 12, 3: 39, 4: 379}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!