|
Left Crispr |
Right Crispr |
| Crispr ID |
909000404 |
909000410 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:70210646-70210668
|
1:70210693-70210715
|
| Sequence |
CCGAGGTTGCAATGAGCTAAAAT |
CAACAGAGCGAGACCCTGTAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 3, 2: 100, 3: 1107, 4: 2326} |
{0: 1, 1: 7, 2: 77, 3: 268, 4: 697} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|