ID: 909432479_909432485

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 909432479 909432485
Species Human (GRCh38) Human (GRCh38)
Location 1:75605648-75605670 1:75605687-75605709
Sequence CCCTAATGGGAAACTACCAAAAG TACTATGGGAATCCACAGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 229} {0: 1, 1: 0, 2: 2, 3: 24, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!