|
Left Crispr |
Right Crispr |
| Crispr ID |
909734097 |
909734099 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:78934449-78934471
|
1:78934465-78934487
|
| Sequence |
CCTAGAAGAAAATGTAGGTAATA |
GGTAATACCATTTAGGACATAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 64, 2: 1174, 3: 10464, 4: 11989} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|