ID: 910630218_910630222

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 910630218 910630222
Species Human (GRCh38) Human (GRCh38)
Location 1:89346249-89346271 1:89346277-89346299
Sequence CCCTGCCATCTTTTGCAGATAAC TCCTTCTGAGAGGCAGCTCTTGG
Strand - +
Off-target summary {0: 6, 1: 192, 2: 177, 3: 141, 4: 252} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!