ID: 910630220_910630222

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 910630220 910630222
Species Human (GRCh38) Human (GRCh38)
Location 1:89346254-89346276 1:89346277-89346299
Sequence CCATCTTTTGCAGATAACTACTC TCCTTCTGAGAGGCAGCTCTTGG
Strand - +
Off-target summary {0: 5, 1: 185, 2: 202, 3: 119, 4: 262} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!