ID: 910638988_910638993

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 910638988 910638993
Species Human (GRCh38) Human (GRCh38)
Location 1:89439938-89439960 1:89439977-89439999
Sequence CCAGTAACAGGCCAAGAGTTGTC ATTATCTGCAGAAGATGGCAGGG
Strand - +
Off-target summary No data {0: 7, 1: 192, 2: 178, 3: 137, 4: 308}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!