ID: 910896478_910896489

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 910896478 910896489
Species Human (GRCh38) Human (GRCh38)
Location 1:92075317-92075339 1:92075363-92075385
Sequence CCTGCAGAGGCCGATGTCTCCTC TTGGTTTCTTCTTTTGAAGTGGG
Strand - +
Off-target summary {0: 3, 1: 2, 2: 3, 3: 6, 4: 128} {0: 1, 1: 1, 2: 8, 3: 49, 4: 626}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!