ID: 910896479_910896490

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 910896479 910896490
Species Human (GRCh38) Human (GRCh38)
Location 1:92075327-92075349 1:92075368-92075390
Sequence CCGATGTCTCCTCCAGTCCCAGA TTCTTCTTTTGAAGTGGGAGTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 2, 3: 29, 4: 341} {0: 1, 1: 1, 2: 5, 3: 49, 4: 449}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!