ID: 910896482_910896494

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 910896482 910896494
Species Human (GRCh38) Human (GRCh38)
Location 1:92075336-92075358 1:92075385-92075407
Sequence CCTCCAGTCCCAGAGCAGGAGGT GAGTGGAGACTGGCGTTTAGGGG
Strand - +
Off-target summary {0: 2, 1: 3, 2: 6, 3: 27, 4: 323} {0: 2, 1: 1, 2: 2, 3: 17, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!