ID: 910896485_910896494

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 910896485 910896494
Species Human (GRCh38) Human (GRCh38)
Location 1:92075344-92075366 1:92075385-92075407
Sequence CCCAGAGCAGGAGGTGGTCTTGG GAGTGGAGACTGGCGTTTAGGGG
Strand - +
Off-target summary {0: 3, 1: 2, 2: 3, 3: 37, 4: 280} {0: 2, 1: 1, 2: 2, 3: 17, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!