ID: 910896487_910896495

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 910896487 910896495
Species Human (GRCh38) Human (GRCh38)
Location 1:92075345-92075367 1:92075398-92075420
Sequence CCAGAGCAGGAGGTGGTCTTGGT CGTTTAGGGGCCATGCTGTTAGG
Strand - +
Off-target summary {0: 3, 1: 2, 2: 1, 3: 19, 4: 206} {0: 2, 1: 0, 2: 3, 3: 6, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!