|
Left Crispr |
Right Crispr |
| Crispr ID |
910948213 |
910948218 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:92616686-92616708
|
1:92616731-92616753
|
| Sequence |
CCTGCCATCTTCTTCAGATAACT |
GTTGGCCTGTTACTGGACTTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 6, 1: 203, 2: 192, 3: 123, 4: 265} |
{0: 1, 1: 14, 2: 198, 3: 174, 4: 181} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|