|
Left Crispr |
Right Crispr |
Crispr ID |
910948213 |
910948219 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:92616686-92616708
|
1:92616734-92616756
|
Sequence |
CCTGCCATCTTCTTCAGATAACT |
GGCCTGTTACTGGACTTTGGTGG |
Strand |
- |
+ |
Off-target summary |
{0: 6, 1: 203, 2: 192, 3: 123, 4: 265} |
{0: 8, 1: 152, 2: 160, 3: 95, 4: 183} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|