|
Left Crispr |
Right Crispr |
Crispr ID |
910948214 |
910948217 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:92616690-92616712
|
1:92616724-92616746
|
Sequence |
CCATCTTCTTCAGATAACTACTC |
GACAGCTGTTGGCCTGTTACTGG |
Strand |
- |
+ |
Off-target summary |
{0: 8, 1: 196, 2: 189, 3: 121, 4: 302} |
{0: 8, 1: 173, 2: 191, 3: 137, 4: 204} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|