|
Left Crispr |
Right Crispr |
| Crispr ID |
911109095 |
911109098 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:94164169-94164191
|
1:94164203-94164225
|
| Sequence |
CCAGTAACAGGCCAAGAGTTGTC |
GAGCAGTTATCTTCAGAAGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 17, 1: 171, 2: 183, 3: 131, 4: 176} |
{0: 1, 1: 12, 2: 203, 3: 215, 4: 287} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|