ID: 911257322_911257326

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 911257322 911257326
Species Human (GRCh38) Human (GRCh38)
Location 1:95647328-95647350 1:95647362-95647384
Sequence CCAGTAACAGGCCAAGAGCTGCC GAGTAGTTATCTGCAGAAGATGG
Strand - +
Off-target summary {0: 9, 1: 173, 2: 187, 3: 147, 4: 210} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!