ID: 911413414_911413427

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 911413414 911413427
Species Human (GRCh38) Human (GRCh38)
Location 1:97540266-97540288 1:97540308-97540330
Sequence CCCACAACCCCTTCTTCGGGTTA CTTACAGAACCCGGGGTGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 45, 4: 211} {0: 1, 1: 0, 2: 1, 3: 17, 4: 381}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!