ID: 911413416_911413427

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 911413416 911413427
Species Human (GRCh38) Human (GRCh38)
Location 1:97540273-97540295 1:97540308-97540330
Sequence CCCCTTCTTCGGGTTAGATTAAC CTTACAGAACCCGGGGTGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 130} {0: 1, 1: 0, 2: 1, 3: 17, 4: 381}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!