ID: 911413418_911413436

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 911413418 911413436
Species Human (GRCh38) Human (GRCh38)
Location 1:97540275-97540297 1:97540319-97540341
Sequence CCTTCTTCGGGTTAGATTAACTG CGGGGTGGGGGGTGGGGGGTGGG
Strand - +
Off-target summary No data {0: 5, 1: 63, 2: 330, 3: 8961, 4: 16381}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!