ID: 911925793_911925798

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 911925793 911925798
Species Human (GRCh38) Human (GRCh38)
Location 1:103830788-103830810 1:103830821-103830843
Sequence CCCACAAGCAGCCTGCAAACTGC CATACACAACTGCCTGCCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 203} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!