ID: 911980425_911980431

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 911980425 911980431
Species Human (GRCh38) Human (GRCh38)
Location 1:104559419-104559441 1:104559467-104559489
Sequence CCTGCCATCTTCTGCAGATAACT GGCCTGTTACTAGGCTTTGGTGG
Strand - +
Off-target summary {0: 185, 1: 187, 2: 104, 3: 111, 4: 225} {0: 11, 1: 153, 2: 154, 3: 85, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!